Skip to main content

Table 1 Primers used in LL-5 cells early infections with wMel and wMelPop-CLA strains

From: Wolbachia introduction into Lutzomyia longipalpis (Diptera: Psychodidae) cell lines and its effects on immune-related gene expression and interaction with Leishmania infantum

Primer name Primer sequence (5'-3') Reference sequence ID
LLiNOS-F TGGCTGTCGCAATTTGTGTG LLOJ005465 (VectorBase)
LLiNOS-R CCGCAATGTTCACCTCAACC
LLCatalase-F CGACCGTGGTATCCCTGATG LLOJ007605 (VectorBase)
LLCatalase-R AGAAGGCCTCCCCTTTGTTG
LLSOD3A-F CCGATAGCGCTGTGAGACAC LLOJ008594 (VectorBase)
LLSOD3A-R ATCGGAAATTGCGACCTTGC
GAPDH-F TTCGCAGAAGACAGTGATGG LLOJ001891 (VectorBase)
GAPDH-R CCCTTCATCGGTCTGGACTA
wsp-F TGGTCCAATAAGTGATGAAGAAAC AF020070.1 (GenBank)
wsp-R AAAAATTAAACGCTACTCCA