Skip to main content

Advertisement

Table 2 Targets, primers and amplicon size for the PCR-testing from ticks and EDTA-blood

From: Combination of microbiome analysis and serodiagnostics to assess the risk of pathogen transmission by ticks to humans and animals in central Germany

Target sequence Designation Sequence (5'-3') Amplicon length (bp) Reference
Bartonella spp. 16S rDNA, 1st round A-proteo AGAGTTTGATC(AC)TGGCTCAGA 1210 [44]
r-Alpha-sh GTAGCACGTGTGTAGCCCA
Bartonella spp. 16S rDNA, 2nd round Bart CACTCTTTTAGAGTGAGCGGCAA 990 [44]
r-BH CCCCCTAGAGTGCCCAACCA
Bartonella 16S-23S ITS region 325s CTTCAGATGATGATCCCAAGCCTTCTGGCG various Bartonella spp., ~500 bp [45]
1100as GAACCGACGACCCCCTGCTTGCAAAGCA
Bartonella spp. rpoB prAPT0244 GATGTGCATCCTACGCATTATGG 406 [51]
prAPT0245 AATGGTGCCTCAGCACGTATAAG
Anaplasma spp. 16S rDNA 1st round ge3A CACATGCAAGTCGAACGGATTATTC 932 [48]
ge10r TTCCGTTAAGAAGGATCTAATCTCC
Anaplasma spp. 16S rDNA 2nd round ge9f AACGGATTATTCTTTATAGCTTGCT 546 [48]
ge2 GGCAGTATTAAAAGCAGCTCCAGG
C. burnetii IS1111 CB_S4k GAAACGGGTGTTGAATTGTTTG 290 [47]
CB_A2k ATCACCAATCGCTTCGTCCCGGT
Rickettsia spp. 23S-5S ITS region 23S for GATAGGTCGGGTGTGGAAGCAC various Rickettsia spp., ~500 bp [46]
23S rev GGGATGGGATCGTGTGTTTCAC
Leptospira spp. LipL32 LipL32-270F CGCTGAAATGGGAGTTCGTATGATT 423 [49]
LipL32-692R CCAACAGATGCAACGAAAGATCCTTT
Borrelia spp. 16S rDNA 16S FW GGCTTAGAACTAACGCTGGCAGTGC 552 [50]
16S RV CCCTTTACGCCCAATAATCCCGA