Skip to main content

Table 1 Details of the qPCR/PCR assays used in the study for the detection of pathogen DNA in flea samples

From: Pathogens in fleas collected from cats and dogs: distribution and prevalence in the UK

Target species (gene) PCR primer and probe sequences (5'-3') Product size (bp) Reference
Flea (18S rRNA) 18S-F: GATCGTACCCACATTACTTG 1200 [27]
18S-R: AAAGAGCTCTCAATCTGTCA
Dipyllidium caninum (28S rRNA) F: GCATGCAAGTCAAAGGGTCCTACG 653 [48]
R: CACATTCAACGCCCGACTCCTGTAG
Bartonella spp. (ssrA) F: GCTATGGTAATAAATGGACAATGAAATAA 299 [28]a
R: GGCTTCTGTTGCCAGGTG
FAM-ACCCCGCTTAAACCTGCGACG-BHQ1
Mycoplasma haemofelis (16S rRNA) F: GTGCTACAATGGCGAACACA 80 [29]
R: TCCTATCCGAACTGAGACGAA
FAM-TGTGTTGCAAACCAGCGATGGT-BHQ1
Candidatus Mycoplasma haemominutum” (16S rRNA) F: TGATCTATTGTKAAAGGCACTTGCT 135 [29]
R: TTAGCCTCYGGTGTTCCTCAA
FAM-TTCAATGTGTAGCGGTGGAATGCGT-BHQ1
Candidatus Mycoplasma turicensis” (16S rRNA) F: AGAGGCGAAGGCGAAAACT 138 [29]
R: ACGTAAGCTACAACGCCGAAA
FAM-CGTAAACGATGGGTATTAGATGTCGGGAT-BHQ1
  1. aThe reverse primer has been modified compared to the one described in the paper