Skip to main content

Table 1 Reverse line blot hybridization probe sequences with a C6 amino linker at the 5′ end

From: “Tekenscanner”: a novel smartphone application for companion animal owners and veterinarians to engage in tick and tick-borne pathogen surveillance in the Netherlands

Probe Sequence (5′–3′) Reference
Ehrlichia/Anaplasma catch-all GGGGGAAAGATTTATCGCTA [21]
Anaplasma phagocytophilum (1) GCTATRAAGAATARTTAGTGG [36]
Anaplasma phagocytophilum (2) TTGCTATRRAGAATARTTAGTGG [37, 38]
Anaplasma platys (2) GTCGTAGCTTGCTATGATA [39]
Ehrlichia canis (2) TCTGGCTATAGGAAATTGTTA [37]
Ca. Neoehrlichia mikurensis” GCTGTAGTTTACTATGGGTA [37]
Theileria/Babesia catch-all TAATGGTTAATAGGARCRGTTG [20]
Babesia catch-all (1) ATTAGAGTGTTTCAAGCAGAC [38]
Babesia catch-all (2) ACTAGAGTGTTTCAAACAGGC [38]
Babesia canis (1) GGTTGGTTATTTCGTTTTCGC This study
Babesia canis (2) TGGTTGGTTATTTCGTTTTCG [38]
Babesia divergens ACTRATGTCGAGATTGCAC [16]
Babesia gibsoni (1) CTGCGTTGCCCGACTCG [36]
Babesia gibsoni (2) TACTTGCCTTGTCTGGTTT [38]
Babesia microti (1) GCTTYCGAGCGTTWTTTTATTG This study
Babesia microti (2) GRCTTGGCATCWTCTGGA [38]
Babesia rodhaini TGTGGATTAGTGCGCAAG [38]
Babesia venatorum CGATTTCGCTTTTGGGATT [12]
Babesia vogeli AGCGTGTTCGAGTTTGCC [41]
Borrelia burgdorferi (s.l.) CTTCCATCTCTAYTTTGCCAAT [42]
Borrelia burgdorferi (s.s.) AACACCAATATTTAAAAAACATAA [19]
Borrelia bissetti/Borrelia carolinensis CACTAACATTTAAAAAATATAAAATAAAAT [42]
Borrelia garinii (2) AACATGAACATCTAAAAACATAAA This study
Rickettsia catch-all TTTAGAAATAAAAGCTAATACCG [45]
Rickettsia conorii CTTGCTCCAGTTAGTTAGT [45]
Rickettsia helvetica GCTAATACCATATATTCTCTATG [45]
Rickettsia massiliae TGGGGCTTGCTCTAATTAGT [46]
Rickettsia raoultii CTAATACCGCATATTCTCTACG [12]
Ca. Midichloria mitochondria” GCGAAATAACAGTTGGAAGCAAT [18]