Skip to main content

Advertisement

Table 1 Targeted organisms and list of primers used in this study

From: Molecular investigation of vector-borne parasitic infections in dogs in Northeast India

Target organism Primer Sequence (5′–3′) Fragment length (bp) Reference
Babesia spp. & Hepatozoon spp. Piroplasmid-F CCAGCAGCCGCGGTAATTCCTTTCGC 400 [6]
Piroplasmid-R AGTAGTTYGTCTTTAACAAATCT
Babesia spp. Babesia18S-F CCGTGCTAATTGTAGGGCTAATACA 551 [7]
Babesia18S-R GCTTGAAACACTCTARTTTTCTCAAAG
Babesia spp. 455-479Fa GTCTTGTAATTGGAATGATGGTGAC 340 [8]
793-772Rb ATGCCCCCAACCGTTCCTATTA
Babesia gibsoni BgibAsia-Fc ACTCGGCTACTTGCCTTGTC 185 [8]
Babesia vogeli BCV-Fd GTTCGAGTTTGCCATTCGTT 192 [8]
Hepatozoon spp. Hepatozoon18S-F GGTAATTCTAGAGCTAATACATGAGC 574 [7]
Hepatozoon18S-R ACAATAAAGTAAAAAACAYTTCAAAG
Ehrlichia spp. E.c 16S-fwd TCGCTATTAGATGAGCCTACGT 123 [3]
Anaplasma spp. E.c 16S-rev GAGTCTGGACCGTATCTCAGT
Anaplasmataceae ECB CGTATTACCGCGGCTGCTGGCA 500 [4]
ECC AGAACGAACGCTGGCGGCAAGC
Ehrlichia canis ECAN5 CAATTATTTATAGCCTCTGGCTATAGGA 400 [4]
HE3 ATAGGGAAGATAATGACGGTACCTATA
Anaplasma platys ApysF GTCGAACGGATTTTTGTCGT 200 [4]
Apys RTAGATCACCGCCTTGGTAGG
Filariid worms Forward TTTAAACCGAAAAAATATTGACTGAC 115 [5]
Reverse AAAAACTAAACAATCATACATGTGCC
  1. aNested PCR outer forward primer
  2. bNested PCR outer reverse primer
  3. cNested PCR inner reverse primer
  4. dNested PCR inner reverse primer