Skip to main content

Table 1 Pathogens, target genes, nucleotide sequences, primer melting temperatures, amplicon sizes (in base pairs) and references

From: Emerging feline vector-borne pathogens in Italy

Target species Target gene Primer sequence (5′–3′) Tm (°C) Amplicon size (bp) Reference
Rickettsia spp. gltA GGGGGCCTGCTCACGGCGG 54 381 [40]
ATTGCAAAAAGTACAGTGAACA
ompB GTAACCGGAAGTAATCGTTTCGTAA 54 511 [41]
GCTTTATAACCAGCTAAACCACC
GTTTAATACGTGCTGCTAACCAA 56 425
GGTTTGGCCCATATACCATAAG
ompA ATGGCGAATATTTCTCCAAAA 50 532 [42]
AGTGCAGCATTCGCTCCCCCT
Piroplasmida 18S rRNA AATACCCAATCCTGACACAGGG 57 408 [43]
TTAAATACGAATGCCCCCAAC
Leishmania spp. 18S rRNA GGTTCCTTTCCTGATTTACG 60 603 [37]
GGCCGGTAAAGGCCGAATAG
TCCCATCGCAACCTCGGTT 358 [44]
AAAGCGGGCGCGGTGCTG