Skip to main content

Advertisement

Table 1 Primer sequences used in qRT-PCR analysis. F and R indicate forward and reverse primers, respectively

From: Immunosuppressive effects of tick protein RHcyst-1 on murine bone marrow-derived dendritic cells

Gene name Primer sequence (5′-3′) Length (bp)
RHcyst-1 F: CACAGTCAGGGAGATTTGCG 96
R: TGCGTGCGATACTTCAGAGG
ELF1α F: CGTCTACAAGATTGGTGGCATT 108
R: CTCAGTGGTCAGGTTGGCAG
STAT3 F: CACCTTGGATTGAGAGTCAAGAC 112
R: AGGAATCGGCTATATTGCTGGT
STAT4 F: GCAGCCAACATGCCTATCCA 97
R: TGGCAGACACTTTGTGTTCCA
STAT5 F: CGCCAGATGCAAGTGTTGTAT 113
R: TCCTGGGGATTATCCAAGTCAAT
p38 F: CTGACCGACGACCACGTTC 118
R: CTTCGTTCACAGCTAGGTTGC
ERK F: CAGGTGTTCGACGTAGGGC 139
R: TCTGGTGCTCAAAAGGACTGA
Mus-actin F: AGAGGGAAATCGTGCGTGAC 195
R: CCATACCCAAGAAGGAAGGCT