Skip to main content

Advertisement

Table 1 Primers used for the amplification of the cytochrome b gene of mitochondrial DNA in mosquito blood meals

From: Identification of the source of blood meals in mosquitoes collected from north-eastern Australia

Primer Sequence (5’-3’) Amplicon length (bp)
VF GAGGMCAAATATCATTCTGAGG 457
VR TAGGGCVAGGACTCCTCCTAGT 457
MAMF TGAGGACAAATATCATTCTGAGG 623
MAMR GGTTGTCCTCCAATTCATGTTA 623
  1. Abbreviations: VF, vertebrate forward; VR, vertebrate reverse; MAMF, mammalian forward; MAMR, mammalian reverse