Skip to main content

Table 1 Primers and probes used for detection of pathogens in body lice

From: Report of the human body louse (Pediculus humanus) from clothes sold in a market in central Italy

Organism Target gene Primer/probe sequence (5′-3′) Reference
Rickettsia prowazekii ompB AATGCTCTTGCAGCTGGTTCT [20]
Bartonella quintana gltA GGGGACCAGCTCATGGTGG [21]
Coxiella burnetii IS1111 GTCTTAAGGTGGGCTGCGTG [22]
Yersinia pestis yer GCAGGAAATGCGCAATGC [23]