Skip to main content

Advertisement

Table 1 Primers and probes used for detection of pathogens in body lice

From: Report of the human body louse (Pediculus humanus) from clothes sold in a market in central Italy

Organism Target gene Primer/probe sequence (5′-3′) Reference
Borrelia spp. 16S RNA AGCCTTTAAAGCTTCGCTTGTAG [19]
GCCTCCCGTAGGAGTCTGG
FAM-CCGGCCTGAGAGGGTGAACGG-TAMRA
Rickettsia prowazekii ompB AATGCTCTTGCAGCTGGTTCT [20]
TCGAGTGCTAATATTTTTGAAGCA
FAM-CGGTGGTGTTAATGCTGCGTTACAACA-TAMRA
Bartonella quintana gltA GGGGACCAGCTCATGGTGG [21]
AATGCAAAAAGAACAGTAAACA
GCAAAAGATAAAAATGATTCTTTCCG-Fluorescin
LC640-CTTATGGGTTTTGGTCATCGAGT-Phosphate
Coxiella burnetii IS1111 GTCTTAAGGTGGGCTGCGTG [22]
CCCCGAATCTCATTGATCAGC
FAM-AGCGAACCATTGGTATCGGACGTT-TAMRA-TATGG
Yersinia pestis yer GCAGGAAATGCGCAATGC [23]
GGGCGGATCCCCACTTTA
FAM-CG AGG TTC AGG TGA GCA CG-TAMRA