Skip to main content

Advertisement

Table 1 Sequences of primers used for cytokine real-time PCR (qPCR) and standard curve data

From: Immune response profile of caruncular and trophoblast cell lines infected by high- (Nc-Spain7) and low-virulence (Nc-Spain1H) isolates of Neospora caninum

Targeta Primer Primer sequence (5′–3′) Product size (bp) R 2 b Slopec
IFN-γ (NM_174086.1) QIFN-UPg GATTCAAATTCCGGTGGATG 110 0.994 (−3.47)–(−3.30)
QIFN-RPg TTCTCTTCCGCTTTCTGAGG
TNF-α (EU276079.1) QTNF-UPg CCAGAGGGAAGAGCAGTCC 126 0.998 (−3.39)–(−3.27)
QTNF-RPg GGAGAGTTGATGTCGGCTAC
IL-4 (M77120.1) QIL4-UPg CTGCCCCAAAGAACACAACT 169 0.995 (−3.33)–(−3.54)
QIL4-RPg GTGCTCGTCTTGGCTTCATT
IL-6 (X68723.1) QIL-6-UPd CTGGGTTCAATCAGGCGATT 150 0.999 (−3.22)–(−3.20)
QIL-6-RPd GGATCTGGATCAGTGTTCTGA
IL-8 (BC103310.1) qIL8-Fwh CCACACCTTTCCACCCCAAA 177 0.995 (−3.36)–(−3.23)
qIL8-Rwh CTTGCTTCTCAGCTCTCTTC
IL-10 (NM_174088.1) QIL10-UPg TGCTGGATGACTTTAAGGGTTACC 60 0.999 (−3.27)–(−3.42)
QIL10-RPg AAAACTGGATCATTTCCGACAAG
IL-12p40 (NM_174356.1) QIL12-UPg AGTACACAGTGGAGTGTCAG 157 0.992 (−3.39)–(−3.35)
QIL12-RPg TTCTTGGGTGGGTCTGGTTT
IL-17 (NM_001008412.1) qIL17bov-uph GAACTTCATCTATGTCACTGC 83 0.997 (−3.30)–(−3.18)
qIL17bov-revh TGGACTCTGTGGGATGATGA
TGF-β1 (NM_001009400.1) QTGF-UPd GGTGGAATACGGCAACAAAA 117 0.999 (−3.60)–(−3.53)
QTGF-RPd CGAGAGAGCAACACAGGTTC
TLR-2 (NM_001048231.1) QTLR2-UPe ACGACGCCTTTGTGTCCTAC 192 0.993 (−3.74)–(−3.38)
QTLR2-RPe CCGAAAGCACAAAGATGGTT
ICAM-1 (NM_174348.2) qICAM-Fwh AGACCTATGTCCTGCCATCG 219 0.994 (−3.34)–(−3.30)
qICAM-Rwh GGTGCCCTCCTCATTTTCCT
VCAM (XM_005204079.2) qVCAM-Fwh GAACTGGAAGTCTACATCTC 128 0.998 (−3.36)–(−3.32)
qVCAM-Rwh CAGAGAATCCGTGGAGCTGG
GAPDH (NM_001034034) GAPDH-Ff ATCTCGCTCCTGGAAGATG 227 0.996 (−3.67)–(−3.58)
GAPDH-Rf TCGGAGTGAACGGATTCG
β-Actin (NM_173979.3) BACTIN-UPg ACACCGCAACCAGTTCGCCAT 216 0.994 (−3.45)–(−3.36)
BACT216-RPg GTCAGGATGCCTCTCTTGCT
  1. aNCBI accession numbers are for cDNA sequences used in primer design. Primer annealing was also checked with the Bos taurus genomic DNA sequences (http://www.ncbi.nlm.nih.gov/nuccore)
  2. bMinimum coefficient of regression (R2) of standard curves for each PCR target in all batches of amplification
  3. cStandard curve slopes. Minimum and maximum values for slopes for each PCR target in all batches of amplification
  4. dPrimer first described by Arraz-Solís et al. [43]
  5. ePrimer first described by Menzies & Ingham [61]
  6. fPrimer first described by Puech et al. [62]
  7. gPrimer first described by Regidor-Cerrillo et al. [9]
  8. hPrimer described in the present work for the first time