Skip to main content

Table 2 Primers used in this study

From: Intracellular localization of vitellogenin receptor mRNA and protein during oogenesis of a parthenogenetic tick, Haemaphysalis longicornis

Experiment Description Sequence (5′–3′)
Real-time PCR HlP0-Fwd CTCCATTGTCAACGGTCTCA
HlP0-Rev TCAGCCTCCTTGAAGGTGAT
HlVgR-Fwd GACCGTTCTTGCTTCTGTCC
HlVgR-Rev GCGACCATCACACCAGTAGA
In situ hybridization T7-HlVgR-1-Fwd TAATACGACTCACTATAGGCTGTCCCTCGGATGACTTCTCCTG
HlVgR-1-Rev CCCCACAGTCGATCATGCCA
HlVgR-1-Fwd CTGTCCCTCGGATGACTTCTCCTG
SP6-HlVgR-1-Rev ATTTAGGTGACACTATAGCCCCACAGTCGATCATGCC
Expression of recombinant HlVgR protein XhoI-HlVgR-Fwd CCGCTCGAGATCTACTGGTGTGATGGT
EcoRI-HlVgR-Rev GGAATTCACAGTGGCTGCTTTCGT