Skip to main content

Advertisement

Table 1 Primers used in the ETAS-PCR/Vgsc-1014, pyrosequencing and TaqMan assays for genotyping the Vgsc-L1014F in C. quinquefasciatus mosquitoes. The Eco32I site is underlined

From: Development and application of a tri-allelic PCR assay for screening Vgsc-L1014F kdr mutations associated with pyrethroid and organochlorine resistance in the mosquito Culex quinquefasciatus

Primer Sequence (5′–3′) Fragment size (bp)
Vgsc-1014/F-T AGTAGCGGATAACAATTTCACACAGGAAGGGTTTTCCCAGTCACGACGTTGATATCGCCACCGTAGTGATAGGAAATATT 181
Vgsc-1014/F-A AGTAGCGGATAACAATTTCACACAGGATATCGAAGGGTTTTCCCAGTCACGACGTTGCCACCGTAGTGATAGGAAATTCA 206
Vgsc-1014/F-C GATATCAGTAGCGGATAACAATTTCACACAGGAAGGGTTTTCCCAGTCACGACGTTGCCACCGTAGTGATAGGAAACTTC 231
Vgsc-1014/R GATCGGTATGAACTGTTTGTTTACATC  
Pyrosequencing assay
 pyr-Vgsc-F CTTGGCCACCGTAGTGATAGG 105
 pyr-Vgsc-R Biotin-GCTGTTGGCGATGTTTTGACA
 pyrSeq. primer CCGTAGTGATAGGAAATTT  
 Dispensation (A/C/T)GTCGTGAGTATTCCAGCGTGAAGTC  
TaqMan assay
 TaqMan-F CTTGGCCACCGTAGTGATAGG  
 TaqMan-R GCTGTTGGCGATGTTTTGACA  
 TaqMan-Probe-TTC FAM-CACGACGAAATTT  
 TaqManProbe-TTT FAM-TCACGACAAAATTT  
 TaqManProbe-TTA VIC-ACTCACGACTAAATTT