Skip to main content

Table 1 Oligonucleotide sequences of primers and probes used for real-time PCRs and conventional PCRs in this study

From: Genetic diversity of human head lice and molecular detection of associated bacterial pathogens in Democratic Republic of Congo

Target Name Sequence (5′–3′) and probes Source
P. humanus
Cytochrome b
Duplex A–D F: GATGTAAATAGAGGGTGGTT [6, 12]
R: GAAATTCCTGAAAATCAAAC
FAM-CATTCTTGTCTACGTTCATATTTGG-TAMRA
VIC-TATTCTTGTCTACGTTCATGTTTGA-TAMRA
Duplex B–C/E F: TTAGAGCGMTTRTTTACCC
R: AYAAACACACAAAAMCTCCT
FAM-GAGCTGGATAGTGATAAGGTTTAT-MGB
VIC-CTTGCCGTTTATTTTGTTGGGGTTT-TAMRA
Monoplex E F: GGTTGGAATTGGATAGTGAT
R: GGGTCCATAAAGAAATCCG
FAM- TAGGAGGCTTTGTGTGTCTATCCT-TAMRA
Cytb F: GAGCGACTGTAATTACTAATC [24]
R: CAACAAAATTATCCGGGTCC
Acinetobacter spp.
RNA polymerase β subunit gene
rpoB F: TACTCATATACCGAAAAGAAACGG [18]
R: GGYTTACCAAGRCTATACTCAAC
FAM-CGCGAAGATATCGGTCTSCAAGC-TAMRA
rpoB (zone1) F: TAYCGYAAAGAYTTGAAAGAAG [25]
R: CMACACCYTTGTTMCCRTGA
R. prowazekii
rOmpB gene
ompB F: AATGCTCTTGCAGCTGGTTCT  
R: TCGAGTGCTAATATTTTTGAAGCA
FAM-CGGTGGTGTTAATGCTGCGTTACAACA-TAMRA
Y. pestis
Plasminogen activator gene
PLA F: ATGGAGCTTATACCGGAAAC [26]
R: GCGATACTGGCCTGCAAG
FAM-TCCCGAAAGGAGTGCGGGTAATAGG-TAMRA
Borrelia spp.
16S ribosomal RNA
Bor16S F: AGCCTTTAAAGCTTCGCTTGTAG [27]
R: GCCTCCCGTAGGAGTCTGG
FAM-CCGGCCTGAGAGGGTGAACGG-TAMRA
B. quintana
Hypothetical intracellular effector
yopP F: TAAACCTCGGGGGAAGCAGA [13]
R: TTTCGTCCTCAACCCCATCA
FAM-CGTTGCCGACAAGACGTCCTTG-TAMRA
3-oxoacyl-synthase gene fabF3 F: GCGGCCTTGCTCTTGATGA
R: GCTACTCTGCGTGCCTTGGA
FAM-TGCAGCAGGTGGAGAGAACGTG-TAMRA
Anaplasma spp.
23S ribosomal RNA
TtAna F: TGACAGCGTACCTTTTGCAT [28]
R: TGGAGGACCGAACCTGTTAC
FAM-GGATTAGACCCGAAACCAAG-TAMRA
C. burnetii
IS1111 spacer
IS1111 F: CAAGAAACGTATCGCTGTGGC [29]
R: CACAGAGCCACCGTATGAATC
FAM-CCGAGTTCGAAACAATGAGGGCTG-TAMRA