Skip to main content

Advertisement

Table 1 List of primers and probes used for detection of bacteria in ticks

From: Comparative proteomics of the vector Dermacentor reticulatus revealed differentially regulated proteins associated with pathogen transmission in response to laboratory infection with Rickettsia slovaca

Target organism/gene Primers and probes Sequence (5′-3′) Reference
Rickettsia sp./gltA CS-F TCGCAAATGTTCACGGTACTTT [33]
CS-R TCGTGCATTTCTTTCCATTGTG
CS-P FAM-TGCAATAGCAAGAACCGTAGGCTGGATG-BHQ
R. slovaca/ompB Rslo351F CAGGTCAAGGTATTACTAATGCAC [34]
Rslo479R CACCGAAGTCTATGCTTCCTACAC
RsloP FAM-TGTAATAATGGTGCTGCTATTGG –TAMRA
R. raoultii/ ompB Rraou2850F2 GTGGTGGTGTTCCTAATACTCC [34]
Rraou2956R2 ACCTAAGTTGTTATAGTCTGTAGTAAAC
Rrao2896P 6-FAM-CGCGATATTGGCACTGTACAGT TAAAGCATCGCG-TAMRA
Babesia sp./18S rRNA BJ1 GTCTTGTAATTGGAATGATGG [35]
BN2 TAGTTTATGGTTAGGACTACG
Coxiella burnetii/16S rRNA CbP1 GGGAAACTCGGGCTAATACC [36]
CbP2 CACGAGGTCCGAAGATCC  
CbP FAM-CCCGCTTTGCTCCAAAGAGATTATG-TAMRA