Skip to main content

Table 1 Primers used in quantitative PCR

From: Comparative analysis of transcriptional profiles of Schistosoma japonicum adult worms derived from primary-infected and re-infected water buffaloes

Primer name Sequence (5′–3′) Product size (bp)
Upregulated genes
 Sjp_0125630F CATGGATCTGTGCTCGCGTA 150
 Sjp_0125630R GCAAACCCGTGATTGGCAAG
 Novel03105F GAGCAGACCGCTTCGATGTA 75
 Novel03105R CCGAATTTCGCTTGCCAGTC
 Novel00129F ACTTCCCGCTCAAGATCACC 103
 Novel00129R ACTCGTAAGAGTGGGGTCCA
 Novel01404F TTCTCAACAGCGTACACCCC 77
 Novel01404R GACCCAGTAGTGCAGACGTT
 Novel02684F GGACGCCAGGTTAAGGAAGA 93
 Novel02684R TCTACCAGCCGAAGGAGTGT
Downregulated genes
 Novel01481F TTGGCCTCAATCGATCCTATCT 136
 Novel01481R CTGTGATTGCTTACCGTTTTGC
 Novel00143F TGTGGGATTAAGGCCTACCA 95
 Novel00143R GCGAACGTAGAACAACTGCC
 Novel02333F CGTTGTATGTGGATCATTTGTGC 70
 Novel02333R TTCATCTTTGCATTCACTACTACAC
 Sjp_0116000F TGCAATTGTTCACCGTGATG 86
 Sjp_0116000R TGTCTCTGCAACATCTTGTGAT
 Novel00935F CGCAATCAGATGTTCAGGGT 105
 Novel00935R TCGGAAACCCAATGTCTGGAT