Skip to main content

Advertisement

Table 1 Primers and probe for the conventional PCR, qPCR and LF-RPA

From: Utilization of recombinase polymerase amplification combined with a lateral flow strip for detection of Perkinsus beihaiensis in the oyster Crassostrea hongkongensis

AssayPrimer/probe nameSequence (5′–3′)Product size (bp)References
PCRPerkITS-85CCGCTTTGTTTGGATCCC703[31]
PerkITS-750ACATCAGGCCTTCTAATGATG[31]
qPCRQ2-FTCGATGAAGGACGCAACGAA291Present study
Q2-RCTCATTTCTGCGGGGCTACA
LF-RPAPits6-FCGATGAAGGACGCAACGAAGTG186Present study
Pits6-Rbiotin-CAAGCGGGATACAAAGCATTAGATT
ProbeFAM-CAGAATTCCGTGAACCAGTAGAAATCTCAA CGCA-(THF)-TACTGCACAAAGGGGA-/C3-spacer/
  1. Abbreviations: LF, lateral flow; RPA, recombinase polymerase amplification