Skip to main content

Advertisement

Table 2 PCR for detection of African trypanosomes

From: Identification of Trypanosoma brucei gambiense in naturally infected dogs in Nigeria

Target taxon/gene Primer name Primer sequence (5’–3’) Annealing temperature (°C) Amplicon size (bp) Reference
Trypanosoma ITS1 TRYP3 TGCAATTATTGGTCGCGC 54 Various sizes according to species [26]
TRYP4 CTTTGCTGCGTTCTT
Subgenus Trypanozoon 177-bp satellite repeat TBR1 GAATATTAAACAATGCGCAG 60 164 (monomer) [27, 32]
TBR2 CCATTTATTAGCTTTGTTGC
T. congolense savannah 350-bp satellite repeat TCS1 CGAGAACGGGCACTTTGCGA 60 316 (monomer) [27]
TCS2 GGACAAACAAATCCCGCACA
T. evansi Type A kDNA minicircle EVA1 ACATATCAACAACGACAAAG 60 139 [33]
EVA2 CCCTAGTATCTCCAATGAAT
T. b. gambiense Group 1 TgsGP gene TgsGP-F GCTGCTGTGTTCGGAGAGC 50 308 [28]
TgsGP-R GCCATCGTGCTTGCCGCTC
T. b. gambiense Group 1 AnTat 11.17 VSG gene AnTA-outer CACAGACGACAGAAGCGATA 50 653 [29]
AnTB-outer GAAAGTGGGAGTTGTTGCTC
AnTC-inner GCCTTCGAAGACACAAGCAG 50 381
AnTD-inner XCGTCGTGCTGAAGTCTCCTG