Skip to main content

Table 1 Wolbachia and Cimex lectularius reference gene primer and TaqMan probe sequences

From: Lack of influence by endosymbiont Wolbachia on virus titer in the common bed bug, Cimex lectularius

Primer/Probe Sequence (5′–3′)
INTF2 AGTCATCATGGCCTTTATGGA
INTR2 TCATGTACTCGAGTTGCAGAGT
Wolbachia Probe TGGTGTCTACAATGGGCTGCAAGG
RPL18F GTATGACGGAGGCAGCTAGG
RPL18R AACATTCGAGCAAATTCGGTA
Cimex Probe ATGAGGACGGTGTTCTTGCCTGTC