Skip to main content

Table 1 Forward and reverse primer sequences used for the amplification of Hematodinium by PCR. Each PCR run included initial denaturation and final extension steps, according to the first and final temperatures, respectively, noted in the thermocycler settings

From: Spatial and temporal disease dynamics of the parasite Hematodinium sp. in shore crabs, Carcinus maenas

Primers Thermocycler settings Amplicon size (bp) References
Direction Name Sequence (5′–3′) Final concentration (µM) Temperature (°C) Time No. of cycles
Forward Hemat-F-1487 CCTGGCTCGATAGAGTTG 0.5 94 10 min 30 187 [57]
Reverse Hemat-R- 1654 GGCTGCCGTCCGAATTATTCAC 94 15 s
54 15 s
72 30 s
72 10 min
Forward 18SF2 CAGTTTCTGGAAGTGGCAGCTG 1 94 1 min 35 480 [58, 59]
Reverse Hem3R TAACCCGAGCCGAGGCATTCA 94 1 min
58 1 min
72 1 min
72 10 min
Forward 18SF2 CAGTTTCTGGAAGTGGCAGCTG 0.5 94 1 min 35 380 [58]
Reverse ITS R1 GAAGGGAAGGGGAGAAGAAGC 94 30 s
57 1 min
72 1 min
72 7 min