Skip to main content

Advertisement

Table 1 Primer sequences for real-time PCR detection of kdr mutations V1016I and F1534C

From: Susceptibility to insecticides and resistance mechanisms in three populations of Aedes aegypti from Peru

Primer Primer sequence (5’-3’)
Val1016f GCGGGCGGCGGGGGCGGGGCCACAAATTGTTTCCCACCCGCACCGG
Ile1016f GCGGGCACAAATTGTTTCCCACCCGCACTGA
Ile1016r TGATGAACCSGAATTGGACAAAAGC
Cys1534+f GCGGGCAGGGCGGCGGGGGCGGGGCCTCTACTTTGTGTTCTTCATCATGTG
Phe1534+f GCGGGCTCTACTTTGTGTTCTTCATCATATT
Phe1534+r TCTGCTCGTTGAAGTTGTCGAT