Skip to main content

Table 2 Primers, annealing temperatures and product size

From: From the feces to the genome: a guideline for the isolation and preservation of Strongyloides stercoralis in the field for genetic and genomic analysis of individual worms

Region amplified Primer Sequence (5′–3′) Annealing T (°C) Product size (bp) Reference
18S HVR-I Forward ZS6492; SSU18Aa AAACATGAAACCGCGGAAAG; AAAGATTAAGCCATGCATG 52 825 (ZS6492 and SSU26R); 862 (SSU18A and SSU26R) [41]
18S HVR-IV Forward 18SP4F GCGAAAGCATTTGCCAA 57 712 [29]
Sequencing ZS6269 GTGGTGCATGGCCGTTC [35]
ytP 274 Forward TJ6026 CAGGACCACCTGGACAAGTT 54 543 [26]
  1. aIn some publications, SSU18A is referred to as SSUA (e.g.[40, 43]); in publications from our department, SSU18A, SSU26R and SSU9R are also referred to as RH5401, RH5402 and RH5403, respectively [35, 44]
  2. Abbreviation: T, temperature