Skip to main content

Advertisement

Table 1 Primers used for qRT-PCR

From: Localized expression and inhibition effect of miR-184 on blood digestion and oviposition in Haemaphysalis longicornis (Acari: Ixodidae)

Vg Forward primer (5′-3′) Reverse primer (5′-3′)
Vg1 CTCACGGCCGACATCGAATA GTTGGTCACGTCGAAGTCCT
Vg2 CCGCCACCATGAGAATCGTA CGTCAGTTGCTGAGGATGGT
Vg3 ATCAATCCACAAGGCAGCGA ATCTTGGTCACTTCCAGCCG