Skip to main content

Table 1 Primers and probes used for molecular analysis of tick-borne pathogens and Ixodes ticks

From: First records of tick-borne pathogens in populations of the taiga tick Ixodes persulcatus in Sweden

OrganismTargetPrimer/Probe nameSequence (5′–3′)Amplicon length (bp)References
A. phagocytophilumgltAApFTTTTGGGCGCTGAATACGAT64Henningsson et al. [33]
ApRTCTCGAGGGAATGATCTAATAACGT
ApMFAM-TGCCTGAACAAGTTATG-BHQ1
Babesia spp.18S rRNABJ1GTCTTGTAATTGGAATGATGG411–452Casati et al. [39]
BN2TAGTTTATGGTTAGGACTACG
Borrelia spp.16S rRNAB16S_FLGAGTCGTCAAGACTGACGCTAAGTC131Wilhelmsson et al. [26]
B16S_RGCACACTTAACACGTTAGCTTCGGTACTAAC
5S–23S rRNA IGSB5S-23S_FCTGCGAGTTCGCGGGAGA225–266Postic et al. [27]
B5S-23S_RTCCTAGGCATTCACCATA
B5S-23S_FnGAGTTCGCGGGAGAGTAAWilhelmsson et al. [26]
B5S-23S_RnTAGGCATTCACCATAGACTCTT
Borrelia miyamotoiflaBBm_FAGAAGGTGCTCAAGCAG156Hovius et al. [28]
Bm_RTCGATCTTTGAAAGTGACATAT
Bm_PFAM-AGCACAACAGGAGGGAGTTCAAGC-BHQ1
N. mikurensis16S rRNANeo_16S_FGTAAAGGGCATGTAGGCGGTTTAA107Labbé Sandelin et al. [32]
Neo_16S_RTCCACTATCCTCTCTCGATCTCTAGTTTAA
Rickettsia spp.gltACS-FTCGCAAATGTTCACGGTACTTT74Stenos et al. [34]
CS-RTCGTGCATTTCTTTCCATTGTG
CS-PFAM-TGCAATAGCAAGAACCGTAGGCTGGATG-BHQ1
17kDARr17kDa.61pGCTCTTGCAACTTCTATGTT434Carl et al. [35]
Rr17kDa.492nCATTGTTCGTCAGGTTGGCG
ompBRc.rompB.4362pGTCAGCGTTACTTCTTCGATGC475Choi et al. [36]
Rc.rompB.4,836nCCGTACTCCATCTTAGCATCAG
Rc.rompB.4,496pCCAATGGCAGGACTTAGCTACT267
Rc.rompB.4,762nAGGCTGGCTGATACACGGAGTAA
gltARH314AAACAGGTTGCTCATCATTC837Wallménius et al. [37]
CSF-RAAGTACCGTGAACATTTGCGA
CS-Ric-RCAGTGAACATTTGCGACGGTA832
CS535dGCAATGTCTTATAAATATTCSequencing primer
TBEV11,054–11,121aF-TBE 1GGGCGGTTCTTGTTCTCC68Schwaiger & Cassinotti [30]
R-TBE 1ACACATCACCTCCTTGTCAGACT
TBE-probe-WTFAM-TGAGCCACCATCACCCAGACACA-BHQ1
1329–1416aTBEE-F6GGCTTGTGAGGCAAAAAAGAA88Gäumann et al. [31]
TBEE-R2TCCCGTGTGTGGTTCGACTT
TBEE-P4HEX-AAGCCACAGGACATGTGTACGACGCC-BHQ1
Ixodes sp.ITS2IXO-I2-F4TCTCGTGGCGTTGATTTGC95Sormunen et al. [25]
IXO-I2-R4CTGACGGAAGGCTACGACG
Ipe-I2-P4FAM-TGCGTGGAAAGAAAACGAG-BHQ1
Iri-I2-P4VIC-TGCTCGAAGGAGAGAACGA-BHQ1
  1. aGenome region of TBEV strain Neudoerfl (U27495)
  2. Abbreviations: FAM, 6-carboxy-fluorescine; HEX, 6-carboxy-hexachlorofluoriscine; VIC, 6-carboxy-rhodamine; BHQ, Black Hole Quencher; IGS, intergenic spacer; ITS, internal transcribed spacer