Skip to main content

Table 1 Ancylostoma spp. isotype-1 β-tubulin primers

From: Multiple drug resistance in the canine hookworm Ancylostoma caninum: an emerging threat?

Primer Sequence (5′–3′) Length (bp) Forward/reverse Codons
ACB1_167_F GGYGCAGGAAACAACTG 17 Forward 167
ACB1_167_R CTTTGGTGAGGGGACAACA 19 Reverse 167
ACB1_200_F GTRGTGGAGCCATACAATGC 20 Forward 198, 200
ACB1_200_R GGCATGAAGAAGTGAAGACGT 21 Reverse 198, 200