Skip to main content

Table 2 The designed primers used for AS-PCR to determine the mutations at 1534 locus in kdr gene of Ae. albopictus

From: Establishment of an innovative and sustainable PCR technique for 1534 locus mutation of the knockdown resistance (kdr) gene in the dengue vector Aedes albopictus

PrimersOrientationSequence (5ʹ–3ʹ)Fragment size (bp)
zhuAFForwardACTCGCGGGAGGTAAGTT530
zhuARReverseGTCCGTCTGCTTGTAGTGAT530
zhu1534FForwardCTTCGTGTTCTTCATCATCTT389
zhu1534SForwardCTTCGTGTTCTTCATCATCTC389
zhu1534CForwardCTTCGTGTTCTTCATCATCTG389
zhu1534L1ForwardCTTCGTGTTCTTCATCATCTTG389
zhu1534L2ForwardCTTCGTGTTCTTCATCATCC389