Skip to main content

Table 1 PCR-RFLP genotyping assays for inversion 2Rb in An. gambiae and An. coluzzii

From: Highly specific PCR-RFLP assays for karyotyping the widespread 2Rb inversion in malaria vectors of the Anopheles gambiae complex

Tag positionConcordRef/AltRestriction enzymeChromosome cutPrimer pairs (5’-3’)Amplicon size (bp)Cleavage products (bp)
2317054296.7%C/TDraIII2R+bF: GCCGTTCTCCAGGCTCAG481348, 133
     R: AAACTCCATTGTACTGGCTGAA  
2644686696.7%G/AMspA12R+bF: TTCACAACGAAATGGCAAGA463264, 199
     R: TAGGGCAGTGTTGAGGGAAC  
2024765196.3%G/ATatI2RbF: AATGGCCAGTCTCGAAAGAA227153, 74
     R: GAAGGGAACGTATGATAATGCAG  
  1. Abbreviations: Tag position, chromosome coordinate; Concord, minimum percent concordance with inversion genotype based on Love et al. [32]; Ref/Alt, reference and alternate allele at tag SNP