Skip to main content

Advertisement

Table 1 Primers designed to target various portions of the mitochondrial cytochrome B gene (cytb) used to differentiate three marsupial and three deer species in two separate multiplex PCRs

From: Multiplex PCRs for the specific identification of marsupial and deer species from faecal samples as a basis for non-invasive epidemiological studies of parasites

SpeciesPrimerSequence (5′-3′)Product size (bp)
Eastern grey kangaroomacFGCATCCATCTTAATTCTCCTCA250
marRGGTTYTAGTATGTAGTTTTCAAA
Swamp wallabywalFGCCCTACTTTCATTAGCAC425
marRGGTTYTAGTATGTAGTTTTCAAA
Common wombatVUCytBFAGCATTCATCGACCTACCCA289
VUCytBRTGTTTCTTTGTAGAGGTAGGAG
Fallow deerDDCytBFAGCAACCTTAACTCGATTCTTC197
DDCytBRAGAGAAATAGGAATAGGATGCC
Red deerCECytbF3CGCAGACAAAATCCCCTTTCA482
CERURGTTTTCGATTGTGCTGGTGA
Sambar deerRUCytbF4CCAGTGCCTATTCTGAATCTTAGC161
CERURGTTTTCGATTGTGCTGGTGA