Skip to main content

Table 1 Sequences of primers used for real-time PCR

From: Angiostrongylus cantonensis Galectin-1 interacts with Annexin A2 to impair the viability of macrophages via activating JNK pathway

GenePrimerSequence (5′–3′)Product size (bp)
β-actinSenseAAACGTGCTGCTGACCGAG119
AntisenseTAGCACAGCCTGGATAGCAAC
ANXA2SenseATGGTCTCCCGCAGTGAAGTG122
AntisenseAGCAGCGCTTTCTGGTAGTCG