Skip to main content

Table 1 List of primer sets used in PCR amplification of 12S rRNA and 16S rRNA genes and the ITS2 region [4, 20]

From: Invasive cattle ticks in East Africa: morphological and molecular confirmation of the presence of Rhipicephalus microplus in south-eastern Uganda

Primer namePrimer sequence (5’-3’)
16S-FTTAAATTGCTGTRGTATT
16S-R1CCGGTCTGAACTCASAWC
ITS2-FACATTGCGGCCTTGGGTCTT
ITS2-RTCGCCTGATCTGAGGTCGAC
T1BAAACTAGGATTAGATACCCT
T2AAATGAGAGCGACGGGCGATGT