Skip to main content

Table 1 Primers and probes utilized in this study

From: Rapid clearance of Borrelia burgdorferi from the blood circulation

Primer name Sequence (5′-3′)
Bp_flaB_fw GAGGGTGCTCAACAAGCAA
Bp_flaB_re CAACAGCAGTTGTAACATTAACTGG
Bp_flaB_probe FAM-AAATCAGGAAGGAGTACAACCAGCAGCA-TAM
BbssN40-ospA 17 fw AATGTTAGCAGCCTTGACGAGAA
BbssN40-ospA 119 re GATCGTACTTGCCGTCTTTGTTT
BbssN40-ospA-41T FAM-AACAGCGTTTCAGTAGATTTGCCTGGTGA-TAM