Skip to main content

Table 1 Primers, annealing temperatures and product size

From: Genomic studies on Strongyloides stercoralis in northern and western Thailand

Region amplifiedPrimerSequence (5′–3′)Annealing T (°C)Product size (bp)
SSU HVR-IForward
Reverse
Sequencing
ZS6492
RS5402
ZS6492
AAACATGAAACCGCGGAAAG
CATTCTTGGCAAATGCTTTCG
AAACATGAAACCGCGGAAAG
50825
SSU HVR-IVForward18SP4FGCGAAAGCATTTGCCAA57712
Reverse18SPCRACGGCCGGTGTGTAC
SequencingZS6269GTGGTGCATGGCCGTTC
cox1ForwardZS6985GGTGGTTTTGGTAATTGAATG47837
ReverseZS6986ACCAGTYAAACCACCAATAGTAA
SequencingZS6990GGTTGATAAACTATAACAGTACC
  1. Note: For more information and references see [21]
  2. Abbreviation: T, temperature