Skip to main content

Table 1 Reported gene primers for medically important mites

From: Divergent domains of 28S ribosomal RNA gene: DNA barcodes for molecular classification and identification of mites

Mite Gene Length (bp) Primers (5’-3’) Reference
D. farinae cox1 832 (4–835) F: GGACGATGATTAATATCCAC Zhao et al. unpublished
R: CAATAGACACTATAGCATAAATCA
16S 402 (65–466) F: TCACACTAAGGTAGCGAG
R: ACGCCGACTTTAACTCA
12S 837 (61–897) F: CGGCTTTGGGAGTTGTAGAA
R: CTTATCTATCAAAAGAGTGACGGG
ITS2 322 (116–437) F: CGAACGCATATTGCAGCCATT
R: ATTCAGGGGGTAATCTCGCTTG
P. cuniculi cox1 652 (61–712) F: GGTGTGTGAAGTGGTATATTG Cheng et al. [36]
R: GCCCAAAAAACCAGAAA
ITS2 275 (108–382) F: GGCTTCGTTTGTCTGAG
R: GTAATCTCGCTTGATCTGA
S. canis cox1 819 (27–845) F: GGTCAACAAATCATAAAGA Zhao et al. [26]
R: CAATAGAAATCATAGCATAAA
16S 320 (94–413) F: TAGGGTCTTTTTGTCTTG
R: TATTATAAAAATATTAAATTAAAAAATTAG
12S 743(61–803) F: CATTAAGCAATTTCCCCA
R: CTAAACAAGAAACACTTTCCA
ITS2 417 (94–510) F: AGTATCCGATGGCTTCGTTTGTCT
R: AATCCCGTTTGGTTTCTTTTCCTC
O. bacoti cox1 479 (442–920) F: CTTCATATYGCWGGTATTTCTT Zhao et al. [10]
R: GTAGCTGTAGTAAAATARGCTCG
16S 267 (97–363) F: TGCTAAGAGAATGGAWDAA
R: CATCGRGGTCGCAAACT
ITS 510 (1–534) F: GGTTTCCGTAGGTGAACC
R: CACTTGATTTCAGATACACGT
C. malaccensis cox1 709 (27–735) F: GGTCAACAAATCATAAAGATATTG Zhao et al. unpublished
R: TAAACTTCAGGGTGACCAAAA
12S 388 (445–832) F: CTAGGATTAGATACCCTATTA
R: ACTATGTTACGACTTATCTATC
Demodex mites cox1 750 (64–813) F: CACATAGAACTTTCAATTCTAAA Hu et al. [2]
R: CTCCTGCTGGGTCGAA
16S 337 (52–388) F: GAGGTATTTTGACTGTGCTA
R: TCAAAAGCCAACATCG
12S 757 (79–835) F: CTACTTTGTTACGACTTATTTTA
R: GCCAGCAGTTTCGGTTA
  1. Abbreviations: F, forward; R, reverse; Tm, melting temperature