Skip to main content

Table 2 Universal or degenerate primers for divergent regions of 28S rDNA for the nine mite species

From: Divergent domains of 28S ribosomal RNA gene: DNA barcodes for molecular classification and identification of mites

Gene fragment Length (bp) Primers (5’-3’) Tm (°C)
D2 532 F: AACAAGTACHGTGAKGGAA 52
R: CTCCTTGGTCCGTGTTTC
D3 252 F: GTCTTGAAACACGGACCAA 54
R: ATCGATTTGCACGTCAGAA
D5 419 F: TTCTGACGTGCAAATCGAT 55
R: GGCAGGTGAGTTGTTACACA
D6 202 F: GTGTGTAACAACTCACCTGCC 55
R: TTGCTACTACCACCAAGATCTG
D7 465 F: CAGATCTTGGTGGTAGTAGCA 55
R: CCTTGGAGACCTGCTGC
D8 314 F: GCAKCAGGTCTCCAAGG 52
R: GTTTTAATTAGACAGTCGGATTC
  1. Abbreviations: F, forward; R, reverse; Tm, melting temperature
  2. Note: The letters in bold in primers indicate degenerate bases