Skip to main content

Table 1 Sequence of primers and probe used for parasite detection [35]

From: Sirolimus enhances the protection achieved by a DNA vaccine against Leishmania infantum

Gene Primer sequence (5ʹ-3ʹ)
Kinetoplastid minicircle DNA F AACTTTTCTGGTCCTCCGGGTAG
R ACCCCCAGTTTCCCGCC
P FAM–AAAAATGGGTGCAGAAAT–MGB
  1. Abbreviations: F, forward primer; R, reverse primer; P, probe