Skip to main content

Table 1 Primers and probes used in the SNP genotyping assay reactions

From: Insecticide resistance, fitness and susceptibility to Zika infection of an interbred Aedes aegypti population from Rio de Janeiro, Brazil

Primer sequence (5′-3′) Probes (5′-3′)
1016for: CGTGCTAACCGACAAATTGTTTCC 1016Val+ VIC-CCGCACAGATACTTA-NFQ
1016rev: GACAAAAGCAAGGCTAAGAAAAGGT 1016Ilekdr FAM-CCCGCACAGGTACTTA-NFQ
1534for: CGAGACCAACATCTACATGTACCT 1534Phe+ FAM-ACGACCCGAAGATGA-NFQ
1534rev: GATGATGACACCGATGAACAGATTC 1534Cyskdr VIC-AACGACCCGCAGATGA-NFQ