Skip to main content

Table 1 Primer sequences for real-time qPCR

From: Excretory/secretory products of Angiostrongylus cantonensis fifth-stage larvae induce endoplasmic reticulum stress via the Sonic hedgehog pathway in mouse astrocytes

Gene   Sequence (5’-3’)
Gfap Forward CAGATCCGAGAAACCAGCCT
Reverse GAGCCTGGCAAACAGGACTA
Grp78 Forward GTGTGTGAGACCAGAACCGT
Reverse AACACACCGACGCAGGAATA
Perk Forward TTTCCATCCTCAGCCCCACA
Reverse GGCACTCACGGAGTCGTATT
eif2α Forward TTACTGTACGCCTGCGCTTT
Reverse CTTCTCACAGCACCGCACTA
Atf4 Forward CGGCTGGTCGTCAACCTATAA
Reverse GGGGTAACTGTGGCGTTAGA
Chop Forward GAGCCAGAATAACAGCCGGA
Reverse TCTGCTTTCAGGTGTGGTGG
Ire1 Forward CCCGGGAAATACATGAGCCA
Reverse CCAGCGGAGGACAAGGAAAT
Traf2 Forward AAGTACCTCTGTTCAGCCTGC
Reverse AGAGAATGGATGCACACCTGA
Atf6 Forward GGGAATGGAAGCCTAAAGAGGA
Reverse ACAGAGAAACAAGCTCGGTGT
Gapdh Forward GGTCCCAGCTTAGGTTCATCA
Reverse TTTGCCGTGAGTGGAGTCAT