Skip to main content

Table 2 Primer sequences used for q-PCR analyses

From: Vaccination with transgenic Eimeria tenella expressing Eimeria maxima AMA1 and IMP1 confers partial protection against high-level E. maxima challenge in a broiler model of coccidiosis

Gene Forward primer (5′-3′) Reverse primer (5′-3′) GenBank ID PMID
GgACTb GAGAAATTGTGCGTGACATCA CCTGAACCTCTCATTGCCA X00182.1 26141544
EmMIC1 TCGTTGCATTCGACAGATTC TAGCGACTGCTCAAGGGTTT M99058 16300767
Gg28S rRNA GGCGAAGCCAGAGGAAACT GACGACCGATTTGCACGTC AH001604 25796577
GgIFNγ GCTCCCGATGAACGACTTGA TGTAAGATGCTGAAGAGTTCATTCG GQ421600.1 20470818
GgIL10 CATGCTGCTGGGCCTGAA CGTCTCCTTGATCTGCTTGATG NM_001004414 29316981