Skip to main content

Table 2 Primers used in the qPCR study

From: Candidate genes for monitoring hydrogen peroxide resistance in the salmon louse, Lepeophtheirus salmonis

Gene Primer name Primer sequence Primer concentration (nM) Product size (bp)
Catalase Ls_Cat_6 F CCACAGAACAACTTGCCAAC 150/150 157
Ls_Cat_6 R GCCATTTCGTCCATAAATGC
Glp1_v2 Ls_Glp1_2 F TCGGCTCCAGGAATTGTTCT 300/300 200
Ls_Glp1_2 R GGTCCTAAATCTCTCGCTGGG
Elongation factor 1-alpha Ls_gEF_2 F ATGGCACGGAGACAACATGT 150/150 206
Ls_gEF_2 R CGGGCACTGTTCCAATACCT
Prohibitin-2 Ls_gProhib2_2 F GCTCATCACACAGCGTCAAC 300/300 176
Ls_gProhib2_2 R CAGCTCTTTGGGCCTCTTGT