Skip to main content

Table 1 Primers used in this study

From: Molecular detection and genetic characteristics of Babesia gibsoni in dogs in Shaanxi Province, China

Target gene Primer name Oligonucleotide sequence (5’-3’) Product size (bp) References
Partial rrs BS1 GACGGTAGGGTATTGGCCT 380 [29]
PiroA ATTACCCAATCCTGACACAGGG
PiroC CCAACAAAATAGAACCAAAGTCCTAC
Nearly complete rrs P1 AACCTGGTTGATCCTGCCAGTAGTCAT 1700 [15]
P2 GAT CCT TCT GCA GGT TCA CCT AC
Partial ITS ITS F GAGAAGTCGTAACAAGGTTTCCG 1100 [15]
ITS 2 ACAATTTGCGTTCAATCCCA
Cytb Bgcytb-F AGTGAAGGAAYTTGACAGGT 1200 This study
Bgcytb-R CTTTCCTATTCCTTACGTAC
Partial TRAP BgTRAPtF1 GTGACACTACAACGTTGTCTG 1100 [30]
BgTRAPtR1 TGTTGATCCTCGTACAGTCC
BgTRAPtF2 GGTTAACAGTGGTTCTGTGAG
BgTRAPtR2 CTGGCGTCCATATCATAGTC