Skip to main content

Table 4 Tandem repeat analysis of TRAP gene fragments

From: Molecular detection and genetic characteristics of Babesia gibsoni in dogs in Shaanxi Province, China

Haplotype No. of positive blood samples No. of repeats Position Consensus pattern Consensus size (bp) No. of copy Percent match
1 28 (NXi’an = 17, NHanzhong = 11)
2 3 (NXi’an = 1, NHanzhong = 2) 3 795–845 GGAGGA 6 8.5 93
796–845 GAGGAAGAGGAA 12 3.9 82
795–845 GGAGGAGGAGGAAGAGGAAGA 21 2.4 96
3 42 (NXi’an = 19, NHanzhong = 23) 5 796–857 GAGGAAGAGGAA 12 4.9 77
796–857 GAGGAGGAGGAAGAGGAA 18 3.3 84
795–857 GGAGGAGGAGGAAGAGGAAGA 21 3.1 84
793–845 GCGGAGGAAGAGGAAGAGGAAGAGGAG 27 2.0 92
823–857 GAGGAA 6 5.8 96
4 6 (NXi’an = 2, NHanzhong = 4 3 795–845 GGAGGAGGAAGAAGAGGAAGA 21 2.6 81
793–845 GCGGAGGAAGAAGAAGAGGAAGAGGAG 27 2.0 88
823–866 GAGGAA 6 5.8 96
5 59 (NXi’an = 36, NHanzhong = 23) 2 795–845 GGAGGAGGAGGAAGAGGAAGA 21 2.4 86
793–845 GCGGAGGAAGAGGAAGAGGAAGAGGAG 27 2.0 92
6 6 (NXi’an = 5, NHanzhong = 1) 4 796–851 GAGGAAGAGGAA 12 4.4 76
796–851 GAGGAGGAGGAAGAGGAA 18 2.9 84
795–851 GGAGGAGGAGGAAGAGGAAGA 21 2.9 84
793–845 GCGGAGGAAGAGGAAGAGGAAGAGGAG 27 2.0 92
7 22 (NXi’an = 17, NHanzhong = 5) 1 795–845 GGAGGAGGAGGAAGAGGAAGA 21 2.4 86
8 6 (NXi’an = 3, NHanzhong = 3) 4 795–845 GGAGGAGGAGGAAGAGGAAGA 21 2.4 86
793–845 GCGGAGGAAGAGGAAGAGGAAGAGGAG 27 2.0 92
823–866 GAGGAAGAGGAT 12 3.7 87
823–857 GAGGAA 6 5.8 96
9 3 (NXi’an = 2, NHanzhong = 1) 3 795–845 GGAGGAGGAGGAAGAGGAAGA 21 2.4 86
793–845 GCGGAGGAAGAGGAAGAGGAAGAGGAG 27 2.0 92
823–866 GAGGAA 6 7.3 89
  1. –, no repeats found