Molecular analysis of polymorphic species of the genus Marshallagia (Nematoda: Ostertagiinae)

Parasites & Vectors

Table 2 Primers and PCR conditions used for molecular analyses of nematodes

Primer	Sequence (5′–3′)	Initial denaturation	Denaturation/annealing/extension	Final elongation
NC1	ACGTCTGGTTCAGGGTTGTT	98 °C for 30 s	40×: 98 °C for 10 s; 55 °C for 30 s; 72 °C for 30 s	72 °C for 10 min
NC2	TTAGTTTCTTTTCCTCCGCT	98 °C for 30 s	40×: 98 °C for 10 s; 55 °C for 30 s; 72 °C for 30 s	72 °C for 10 min
COI_Nema_Fw	GAAAGTTCTAATCATAARGATATTGG	95 °C for 2 min	35×: 95 °C for 1 min; 48 °C for 1 min; 72 °C for 1 min	72 °C for 5 min
COI_Nema_Rv	ACCTCAGGATGACCAAAAAAYCAA	95 °C for 2 min	35×: 95 °C for 1 min; 48 °C for 1 min; 72 °C for 1 min	72 °C for 5 min

ISSN: 1756-3305