Skip to main content

Table 1 Primer and probe sets for the TaqMan assays

From: Laboratory transmission potential of British mosquitoes for equine arboviruses

Virus Sense primer (5’-3’) Probe (5’-3’) Antisense primer (5’-3’) Reference
VEEV TCCATGCTAATGCYAGAGCGTTTTCGCA Fam-TGATCGARACGGAGGTRGAMCCATCC-Tamra TGGCGCACTTCCAATGTCHAGGAT Vina-Rodriqez et al. [45]
RRV TTGCCGGTGGGTAGAGAGAA Fam-ACCACACTTTGGCGTAGAGC-Tamra TCTGGCGGTGTATGCATGTC This studya
JEV ATCTGGTGYGGYAGTCTCA Fam-CGGAACGCGAWCCAGGGCAA-Tamra CGCGTAGATGTTCTCAGCCC Pyke et al. [81]
  1. aDesigned using Primer-BLAST [82]