Field-deployable molecular diagnostic platform for arbovirus detection in Aedes aegypti

Parasites & Vectors

Table 1 Primer pairs for viral detection and cross-reactivity panel for real-time qPCR using the bCUBE

Primer	Sequence (5′–3′)	Nucleotide position	Amplicon size (bp)		References
ZIKV-forward	AGCAACATGGCGGAGGTAAG	1128–1147	145	FSS13025	This study; [34]^a
ZIKV-reverse	CTGTCCACTAACGTTCTTTTGCAGA	1249–1273	145	FSS13025	This study; [34]^a
DENV2-forward	TCCCTTCCAAATCGCAGCAACAATG	10,517–10,541	168	NC_001474.2	This study; [35]^b
DENV2-reverse	CGTTCTGTGCCTGGAATGATG	10,665–10,685	168	NC_001474.2	This study; [35]^b
wAlbB-forward	CCTTACCTCCTGCACAACAA	213,522–213,541	110	CP031221.1	[36]
wAlbB-reverse	GGATTGTCCAGTGGCCTTA	213,394–213,412	110	CP031221.1	[36]
WNV-forward	TTGTGTTGGCTCTCTTGGCGTTCTT	233–257	408	AF196835	[38]
WNV-reverse	CAGCCGACAGCACTGGACATTCATA	640–616	408	AF196835	[38]
JEV-forward	GGCAGAAAGCAAAACAAAAGA	390–410	367	AF080251	[39]
JEV-reverse	CGGATCTCCTGCTTCGCTTGG	736–756	367	AF080251	[39]
YFV-forward	CACGGCATGGTTCCTTCCA	5656–5674	71	MN708497	[37]
YFV-reverse	ACTCTTTCCAGCCTTACGCAAA	5707–5728	71	MN708497	[37]
CHIKV-forward	TACAGGGCTCATACCGCATC	10,357–10,376	154	NC_004162	[40]
CHIKV-reverse	AAAGGTGTCCAGGCTGAAGA	10,492–10,511	154	NC_004162	[40]

^aZIKV primers were modified and optimized for qRT-PCR
^bDENV2 primers were modified and optimized for qRT-PCR
Notes: The cross-reactivity panel primer sequences were included to confirm viral RNA obtained from BEI Resources. Four viruses were included in this study: West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and chikungunya virus (CHIKV). Primer sequence, nucleotide position and amplicon size are listed

ISSN: 1756-3305