Skip to main content

Table 1 Primer pairs for viral detection and cross-reactivity panel for real-time qPCR using the bCUBE

From: Field-deployable molecular diagnostic platform for arbovirus detection in Aedes aegypti

Primer Sequence (5′–3′) Nucleotide position Amplicon size (bp) Accession number References
ZIKV-forward AGCAACATGGCGGAGGTAAG 1128–1147 145 FSS13025 This study; [34]a
ZIKV-reverse CTGTCCACTAACGTTCTTTTGCAGA 1249–1273
DENV2-forward TCCCTTCCAAATCGCAGCAACAATG 10,517–10,541 168 NC_001474.2 This study; [35]b
DENV2-reverse CGTTCTGTGCCTGGAATGATG 10,665–10,685
wAlbB-forward CCTTACCTCCTGCACAACAA 213,522–213,541 110 CP031221.1 [36]
wAlbB-reverse GGATTGTCCAGTGGCCTTA 213,394–213,412
WNV-forward TTGTGTTGGCTCTCTTGGCGTTCTT 233–257 408 AF196835 [38]
WNV-reverse CAGCCGACAGCACTGGACATTCATA 640–616
JEV-forward GGCAGAAAGCAAAACAAAAGA 390–410 367 AF080251 [39]
JEV-reverse CGGATCTCCTGCTTCGCTTGG 736–756
YFV-forward CACGGCATGGTTCCTTCCA 5656–5674 71 MN708497 [37]
YFV-reverse ACTCTTTCCAGCCTTACGCAAA 5707–5728
CHIKV-forward TACAGGGCTCATACCGCATC 10,357–10,376 154 NC_004162 [40]
CHIKV-reverse AAAGGTGTCCAGGCTGAAGA 10,492–10,511
  1. aZIKV primers were modified and optimized for qRT-PCR
  2. bDENV2 primers were modified and optimized for qRT-PCR
  3. Notes: The cross-reactivity panel primer sequences were included to confirm viral RNA obtained from BEI Resources. Four viruses were included in this study: West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV) and chikungunya virus (CHIKV). Primer sequence, nucleotide position and amplicon size are listed