Skip to main content

Table 1 Primers used for confirmation of co-infections and identification of Anaplasma marginale genotypes

From: Epidemiology and genotyping of Anaplasma marginale and co-infection with piroplasms and other Anaplasmataceae in cattle and buffaloes from Egypt

Pathogen Amplified gene Primer sequences (5’–3’) Fragment size (bp) Annealing T (℃) References
Anaplasma spp. GroEL GroEL‐F2: ATG(GT)CAAATACGGT(AT)GTCACGG 855 62 This study
GroEL‐R8: TCRCCAAGCATRTCYTTTCTTC
Anaplasma/ Ehrlichia spp. 16S rRNA FD1: AGAGTTTTGATCCTGGCTCAG* 426 55 [25]
EHR1: TAGCACTCATCGTTTACAGC
GA1UR: GAGTTTGCCGGGACTTCTTCT
Babesia spp. 18S rRNA BJ1: GTCTTGTAATTGGAATGATGG 400–500 55 [26]
BN2: TAGTTTATGGTTAGGACTACG
Theileria spp. 18S rRNA THfor: TGACACAGGGAGGTAGTGA 500 65 [27]
THrev: TCAGCCTTGCGACCATACT
A. marginale MSP1α 1st PCR
MSP1α 2nd PCR
1733F: TGTGCTTATGGCAGACATTTCC
3134R1: TCACGGTCAAAACCTTTGCTTACC
800–1000 55 [9]
1733F: TGTGCTTATGGCAGACATTTCC
2957R2: AAACCTTGTAGCCCCAACTTATCC
60
  1. Abbreviation: T, temperature