Skip to main content

Table 1 PCR systems used in this study and their sources

From: Tabanids as possible pathogen vectors in Senegal (West Africa)

Targeted organism Target gene Name Primers (5′–3′) and probe Tm* (°C) Reference
Tabanidae cox1 LCO1490 GGTCAACAAATCATAAAGATATTGG 50 [49]
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
Hosts 16S 16SA-2290 CGCCTGTTTACCAAAAACAT 50 [50]
16SB-2860 CCGGTCTGAACTCAGATC ACGT
Leishmania donovani complex kDNA RV1 CTTTTCTGGTCCTCCGGGTAGG 60 [51]
RV2 CCACCCGGCCCTATTTTACACCAA
Probe. Leish* FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA
Leishmania spp. ITS1 rDNA-10 F CAATACAGGTGATCGGACAGG 55 [52]
rDNA-14 R CACGGGGATGACACAATAGAG
Piroplasmida 5.8S 5.8S-F5 AYYKTYAGCGRTGGATGTC 60 [53]
5.8S-R TCGCAGRAGTCTKCAAGTC
5.8S-S* FAM-TTYGCTGCGTCCTTCATCGTTGT-MGB
Trypanosoma spp. 5.8S S. 5.8 S Tryp sp. FAM-GTTGAAGAACGCAGCAAAGIGCGAT-TAMRA 60 [37]
F. 5.8 S Tryp sp. CAACGTGTCGCGATGGATGA
R. 5.8 S Tryp sp. ATTCTGCAATTGATACCACTTATC
28S F2 28S ACCAAGGAGTCAAACAGACG 58
R1 28S GACGCCACATATCCCTAAG
ITS1 ITS1-CF CCGGAAGTTCACCGATATTG 58 [54]
ITS1-BR TTGCTGCGTTCTTCAACGAA
Kinetoplastida spp. 28S F2 28S ACCAAGGAGTCAAACAGACG 58 [55]
R1 28S GACGCCACATATCCCTAAG
18S F 720 GTTAAAGGGTTCGTAGTTGAA 50 This study
R1495 GACTACAATGGTCTCTAATCA
Coxiella burnetii IS1111 F CAAGAAACGTATCGCTGTGGC 60 [56]
R CACAGAGCCACCGTATGAATC
S FAM- CCGAGTTCGAAACAATGAGGGCTG-TAMRA
Anaplasmataceae 23S TtAna-F TGACAGCGTACCTTTTGCAT 60 [57]
TtAna-R GTAACAGGTTCGGTCCTCCA
TtAna-S* FAM-CTTGGTTTCGGGTCTAATCC-TAMRA
Borrelia spp. 16S Bor_16S_3F AGCCTTTAAAGCTTCGCTTGTAG 60 [58]
Bor_16S_3R GCCTCCCGTAGGAGTCTGG
Bor_16S_3P FAM- CCGGCCTGAGAGGGTGAACGG-TAMRA
Ricketssia spp. Citrate synthase (gltA) RKNDO3_F GTGAATGAAAGATTACACTATTTAT 60 [46]
RKNDO3_R GTATCTTAGCAATCATTCTAATAGC
RKNDO3_S FAM-CTATTATGCTTGCGGCTGTCGGTTC-TAMRA
gltA (First PCR) CS2D ATGACCAATGAAAATAATAAT 54 [59
CSEndR CTTATACTCTCTATGTACA
gltA (nested PCR) 409D CCTATGGCTATTATGCTTGC 54
1258R ATTGCAAAAAGTACAGTGAACA
Mansonella spp. ITS Manso_ITS_F CCTGCGGAAGGATCATTAAC 60 [20]
Manso_ITS_R ATCGACGGTTTAGGCGATAA
Manso_ITS_P FAM- CGGTGATATTCGTTGGTGTCT-TAMRA
Filariae 18S Fwd.18S.631 TCGTCATTGCTGCGGTTAAA 54 [60]
Rwd.18S.1825r GGTTCAAGCCACTGCGATTAA