Skip to main content

Table 1 Primer sequences used for diagnostic testing of Wolbachia

From: Wolbachia in mosquitoes from the Central Valley of California, USA

Test Gene target PCR product (bp) Primer name Sequence (5ʹ-3ʹ) References
Wolbachia presence 16S rRNA 438 W16S-F CATACCTATTCGAAGGGATAG [56, 95, 96]
W16S-R TTGCGGGACTTAACCCAACA
wsp (General) 185 wsp-F GCATTTGGTTAYAAAATGGACGA [97]
wsp-R GGAGTGATAGGCATATCTTCAAT
Wolbachia density RpS3 70 RpS3-F AGCGTGCCAAGTCGATGAG [98]
RpS3-R ACGTACTCGTTGCACGGATCTC
Supergroup A/B identification wsp (Supergroup A) 556 136F TGAAATTTTACCTCTTTT [65]
691R AAAAATTAAACGCTACTCCA
wsp (Supergroup B) 442 81F TGGTCCAATAAGTGATGAAGAAAC  
522R ACCAGCTTTTGCTTGATA
Multilocus sequence typing gatB 396 gatB_F1 GAKTTAAAYCGYGCAGGBGTT [57]
gatB_R1 TGGYAAYTCRGGYAAAGATGA  
coxA 402 coxA_F1 TTGGRGCRATYAACTTTATAG  
coxA_R1 CTAAAGACTTTKACRCCAGT  
hcpA 444 hcpA_F1 GAAATARCAGTTGCTGCAAA  
hcpA_R1 GAAAGTYRAGCAAGYTCTG  
ftsZ 435 ftsZ_F1 ATYATGGARCATATAAARGATAG  
ftsZ_R1 TCRAGYAATGGATTRGATAT  
fbpA 429 fbpA_F1 GCTGCTCCRCTTGGYWTGAT  
fbpA_R1 CCRCCAGARAAAAYYACTATTC