Skip to main content

Table 1 Sequences of LAMP primers for the amplification of a partial consensus sequence based on the linear genomic DNA partial sequence in the 18S rDNA from Trichuris muris and T. trichiura

From: Whip-LAMP: a novel LAMP assay for the detection of Trichuris muris-derived DNA in stool and urine samples in a murine experimental infection model

Primer Length (bp) Sequence (5′–3′)
F3 20 ACTTTCGATGGTACGCTACG
B3 20 GCGTCTCATGGAGAATCGTT
FIP (F1c+F2) 40 TCTCAGGCTCCCTCTCCGGA-TGCTTACCATGGTGACAACG
BIP (B1c+B2) 41 GGCTACCACATCCAAGGAAGGC-GTCACTACCTCCCCGATCT
  1. Abbreviations: F3, forward outer primer; B3, reverse outer primer; FIP, forward inner primer (comprising F1c and F2 sequences); BIP, reverse inner primer (comprising B1c and B2 sequences)