Skip to main content

Table 1 Primers used for reverse transcription-quantitative real-time polymerase chain reaction analysis of long noncoding RNA (lncRNA)/gene expression

From: RNA sequencing analysis of altered expression of long noncoding RNAs associated with Schistosoma japonicum infection in the murine liver and spleen

lncRNA/gene Forward primer sequences (5′–3′) Reverse primer sequences (5′–3′)
NONMMUT057813.2 TTAAATGCTGGGCCTGGGTT ACAGCCTTCTGCACAGTACC
NONMMUT033668.2 CGGGGGAGCATTACCCTTTT GAGCCAAGCTCCACAGACTT
NONMMUT055723.2 CGTAGAACGCATGGAGTGGA CCAGGTGGCAACAGGAATCT
NONMMUT050583.2 GGCAAGCAGAATAGGTGGGT GCCACACCACTTCCTAACCA
NONMMUT036430.2 GCCACTGGGTGCTACACATA AGAGGCTCACAAGCACAGAC
NONMMUT001686.2 TGTGAAGTGCTGTGGCTAGG ACTTGGTTCCCCGAGTTGTC
NONMMUT060075.2 CCCAGGGTGATCTTGTTGCT GCTGGGTCTCCTGATTTGCT
NONMMUT063222.2 AACTGGCCTTTCTCTGCTGG AGGACTTGACCACCCAGTCT
NONMMUT028556.2 TGGCATTGTTCATGGGGAGT ACAGACCCTGGGGTGTATTT
NONMMUT033611.2 TGGCATAGAGGCCGTCTAACT GAAATGAGGCTCCTAGATGTTTAGC
NONMMUT014792.2 TGTCATCACTAACATGGGCCAG TCATATCGTCATTGAAAGCACAGCC
NONMMUT031907.2 GAAAACTGCTAAGCGCGGTG GGTCTCAACCATGCAACCCT
NONMMUT061096.2 ACCCCAATTCCTGAGACGTG GTTCAGAACTTGGCGCCTTC
NONMMUT047510.2 AGGTGTTTTCACCAGCCACA AGCGAAATGCAAGACGAGGA
ENSMUST00000185516 AGGATTTGTGTCTTGCGTTGTAT TTCAGTTGCAGGTGTCGGAA
XCR1 CACCGAACAGTCAGGCTCAT GTCCAGTTGCTGAAGGCTCT
VCAM1 GAATGAGGGGGCCAAATCCA GACAGGTCTCCCATGCACAA
SAMHD1 CGAGCACTTGCCGAAAAACA CTCAATGGAGCCCTGTTCGT
CCR5 ACACCCTGTTTCGCTGTAGG GACAGGGTTTAGGCAGCAGT
GLCCI1 CCCAACCGGATCAGCTTTCT GCTGCTCTACGGTCAGTGTT
IRS1 AGAACGAGAAGAAGTGGCGG CCTTTGCCCGATTATGCAGC
EXO1 ATGCACACACCCCGTCTAAG ATTTAGAGGCTGGCCGCTTT
FRY TGTGATGCAGCCAGTTACCTT GTCTCTGCATCTACGAACGGTG
CCDC137 GGACAGCGCAGCAAAGAAAA CGTAGGCCACATCAGACTCC
TTYH1 CTCCTGGTGCTTGTCCTGAG GTTGGAAGGGGTTGGAGACC
TGFβ-1 TGTGTTGGTTGTAGAGGGCAAGGA TTTGGAGCCTGGACACACAGTACA
JAK3 GAGCCAAGTATCCTACCCGC GAGGAAGGCCTTTGTCCTCC
STAT1 AAGTCTGGCAGCTGAGTTCC TACCACAGGATAGACGCCCA
GAPDH GGTGAAGGTCGGTGTGAACG ACCATGTAGTTGAGGTCAATGAAGG
  1. XCR1 Chemokine C motif receptor 1, VCAM1 vascular cell adhesion molecule 1, SAMHD1 SAM domain and HD domain 1, CCR5 chemokine C–C motif receptor 5, GLCC1 glucocorticoid-induced transcript 1, IRS1 insulin receptor substrate 1, EXO1 exonuclease 1, FRY furry homolog Drosophila, CCDC137 coiled coil domain containing 137, TTYH1 tweety homolog 1 Drosophila, TGFβ-1 transforming growth factor beta 1, JAK3 Janus kinase 3, STAT 1 signal transducer and activator of transcription 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase