Skip to main content

Table 1 Primers used in this study

From: Molecular identification of native Wolbachia pipientis in Anopheles minimus in a low-malaria transmission area of Umphang Valley along the Thailand-Myanmar border

Type Targets Primer names Primer sequence (5ʹ–3ʹ)
Nested PCR Wolbachia 16S rRNA W-SpecF CATACCTATTCGAAGGGATAG
W-SpecR AGCTTCGAGTGAAACCAATTC
16SNF GAAGGGATAGGGTCGGTTCG
16SNR CAATTCCCATGGCGTGACG
qPCR Plasmodium 18S rRNA PlasF CTTAGTTACGATTAATAGGAGTAGC
PlasR GAAAATCTAAGAATTTCACCTCTGA
Wolbachia 16S rRNA W-SpecF CATACCTATTCGAAGGGATAG
W16S TTGCGGGACTTAACCCAACA
An. minimus ITS2A ITS2A TGT GAA CTG CAG GAC ACA T
MIA CCC GTG CGA CTT GAC GA