Skip to main content

Advertisement

Table 1 List of the primers designed for rnc operon characterization and Asaia sp. molecular identification

From: Molecular characterization of RNase III protein of Asaia sp. for developing a robust RNAi-based paratransgensis tool to affect the sexual life-cycle of Plasmodium or Anopheles fitness

Primer nameSequence (5ʹ–3ʹ)
16S rRNA-FTGGCGGACGGGTGAGTATC
16s rRNA-RAGTTGGTTTGACCCGAAGCC
F566-3WCTTTACCATCGCGGTTTCTGCTATG
F624-3WCGCCAGGCCGAGAGTGAG
F652-3WCCCTGCTTCGGCGATTGAAC
R32-5WTCGCAGAAGCCCCTGATCAG
R161-5WCAGACCGAGCACACGATCAC
R182-5WAAGCAGCCATTCAGCCATCAG
F1GCCACCAGTTTGCTGATCAGG
F2TGACGACTCATGACGCCATAGC
F3CGTGTGCTCGGTCTGCTGATG
F4CATATTGCGGAACATGAGGAGCAG
F5GTTCAGGCCGACGCG
R1ATGCCTTTACGGCCACGGTTCAATC
R2GGCGGCGTGATCTGCGAG
R3CCTCCATCGCGTCGGCCTG’
R4CAGCCTCACTCTCGGCCTG
rnc-clFAAGCTTGCATGACGACTCATGACGCCATAGCGGAG’
rnc-clRCTCGAGTTTTTCTATCCTTCGTGCCTTTACGGCCAC